Location
| |
| Synonyms |
- RH4107
- STS419
- D16S400
- RH42031
- RH54813
- STS22068
- AFM024xg1
- AFM024xg1a
- AFM024xg1m
- AFM024xg1a/AFM024xg1m
|
| Marker types |
- STS mapped on RH map
- Polymorphic marker
- STS mapped on YAC contig
|
| External Links |
--
|
Radiation Hybrid Mapping
According to:
|
AFM024xg1 (G3 panel) from Stanford
| Location (cR10,000): | 2303 cR |
| Bin 54 |
AFM024xg1 (G3 panel) from GeneMap
| Location (cR10,000): | 2747 cR |
| Lod Score: | F |
| Data obtained from: | Stanford Human Genome Center |
| Marker type: | microsatellite |
| RHDB ID RH34740 |
AFM024xg1 (GeneBridge 4 panel) from GeneMap
| Location (cR3000): | 386.13 cR |
| Lod Score: | P1.02 |
| Data obtained from: | Whitehead Institute/MIT Center for Genome Research |
| Marker type: | microsatellite |
| RHDB ID RH4107 |
|
Linkage Mapping
According to:
|
Entry AFM024xg1 from Genethon
| Location: | 81.8 cM |
| Heterozygosity: | 0.61 |
| Number of Alleles: | 3 |
| Allele Size Range: | 192 - 202 bp |
Entry AFM024xg1 from Marshfield
| Location: | 83.55 cM |
| Heterozygosity: | 0.60 |
| Allele Size Range: | 192 - 202 bp |
|
STS to YAC Content Mapping
According to:
|
Entry AFM024XG1 from Whitehead
|
Sequences
According to:
|
Entry AFM024xg1 from Genethon
| CA strand primer: | GTCATCCGACTTCTCACAGG |
| GT strand primer: | AATATGAACCCTCCATGCTG |
| Allele Size Range: | 192 - 202 bp |
Full Sequence
|
Entry AFM024XG1 from Whitehead
| Left strand primer: | GTCATCCGACTTCTCACAGG |
| Right strand primer: | AATATGAACCCTCCATGCTG |
| Product Size: | 201 |
| Primer 1: | GTCATCCGACTTCTCACAGG |
| Primer 2: | AATATGAACCCTCCATGCTG |
| Product Size: | 192
|
GeneMap Primers:
| Left strand primer: | GTCATCCGACTTCTCACAGG |
| Right strand primer: | AATATGAACCCTCCATGCTG |
| Product Size: | 201 |
|
