Location
| |
| Synonyms |
- D19S409
- AFM269xg5
- AFM269xg5a
- AFM269xg5m
- * AFM269xg5
- AFM269xg5a/AFM269xg5m
|
| Marker types |
- STS mapped on RH map
- Polymorphic marker
- STS mapped on YAC contig
|
| External Links |
--
|
Radiation Hybrid Mapping
According to:
|
AFM269xg5 (G3 panel) from Stanford
| Location (cR10,000): | 1046 cR |
| Bin 14 |
AFM269xg5 (G3 panel) from GeneMap
| Location (cR10,000): | 1057 cR |
| Lod Score: | F |
| Data obtained from: | Stanford Human Genome Center |
| Marker type: | microsatellite |
| RHDB ID RH617 |
|
Linkage Mapping
According to:
|
Entry AFM269xg5 from Genethon
| Location: | 51.0 cM |
| Heterozygosity: | 0.60 |
| Number of Alleles: | 5 |
| Allele Size Range: | 167 - 177 bp |
Entry * AFM269xg5 from Marshfield
| Location: | 51.88 cM |
| Heterozygosity: | 0.60 |
| Allele Size Range: | 167 - 177 bp |
|
STS to YAC Content Mapping
According to:
|
Entry AFM269XG5 from Whitehead
|
Sequences
According to:
|
Entry AFM269xg5 from Genethon
| CA strand primer: | GGGGGGCTGATTAGTG |
| GT strand primer: | CAACCCCCAAAGGATG |
| Allele Size Range: | 167 - 177 bp |
Full Sequence
|
Entry AFM269XG5 from Whitehead
| Left strand primer: | GGGGGGCTGATTAGTG |
| Right strand primer: | CAACCCCCAAAGGATG |
| Product Size: | 172 |
| Primer 1: | GGGGGGCTGATTAGTG |
| Primer 2: | CAACCCCCAAAGGATG |
| Product Size: | 167
|
GeneMap Primers:
| Left strand primer: | TGTCTTTCCAGACAATGGTC |
| Right strand primer: | GCACCTGTGGAGTGTACAGT |
| Product Size: | 288 |
|