Location
| |
| Synonyms |
- RH9648
- D19S412
- RH55715
- STS1974
- STS27442
- AFM284yg5
- WI_RHID66
- AFM284yg5a
- AFM284yg5m
- AFM284yg5a/AFM284yg5m
|
| Marker types |
- STS mapped on RH map
- Polymorphic marker
|
| External Links |
--
|
Radiation Hybrid Mapping
According to:
|
AFM284YG5 (G3 panel) from Stanford
| Location (cR10,000): | 2350 cR |
| Bin 37 |
AFM284yg5 (G3 panel) from GeneMap
| Location (cR10,000): | 2361 cR |
| Lod Score: | F |
| Data obtained from: | Stanford Human Genome Center |
| Marker type: | microsatellite |
| RHDB ID RH1104 |
AFM284yg5 (GeneBridge 4 panel) from GeneMap
| Location (cR3000): | 255.92 cR |
| Lod Score: | P1.18 |
| Data obtained from: | Whitehead Institute/MIT Center for Genome Research |
| Marker type: | microsatellite |
| RHDB ID RH55715 |
|
Linkage Mapping
According to:
|
Entry AFM284yg5 from Genethon
| Location: | 69.9 cM |
| Heterozygosity: | 0.80 |
| Number of Alleles: | 9 |
| Allele Size Range: | 89 - 113 bp |
Entry AFM284yg5 from Marshfield
| Location: | 70.14 cM |
| Heterozygosity: | 0.80 |
| Allele Size Range: | 89 - 113 bp |
|
STS to YAC Content Mapping
According to:
|
--
|
Sequences
According to:
|
Entry AFM284yg5 from Genethon
| CA strand primer: | TGAGCGACAGAATGAGACT |
| GT strand primer: | ACATCTTACTGAATGCTTGC |
| Allele Size Range: | 89 - 113 bp |
Full Sequence
|
Entry AFM284YG5 from Whitehead
| Left strand primer: | TGAGCGACAGAATGAGACT |
| Right strand primer: | ACATCTTACTGAATGCTTGC |
| Product Size: | 101 |
| Primer 1: | TGAGCGACAGAATGAGACT |
| Primer 2: | ACATCTTACTGAATGCTTGC |
| Product Size: | 109
|
GeneMap Primers:
| Left strand primer: | TGAGCGACAGAATGAGACT |
| Right strand primer: | ACATCTTACTGAATGCTTGC |
| Product Size: | 101 |
|
