Location
| |
| Synonyms |
- RH15455
- STS4833
- D11S1349
- AFM323wf5
- AFM323wf5a
- AFM323wf5m
- AFM323wf5a/AFM323wf5m
|
| Marker types |
- STS mapped on RH map
- Polymorphic marker
- STS mapped on YAC contig
|
| External Links |
--
|
Radiation Hybrid Mapping
According to:
|
AFM323wf5 (G3 panel) from Stanford
| Location (cR10,000): | 403 cR |
| Bin 16 |
AFM323wf5 (G3 panel) from GeneMap
| Location (cR10,000): | 403 cR |
| Lod Score: | F |
| Data obtained from: | Stanford Human Genome Center |
| Marker type: | microsatellite |
| RHDB ID RH565 |
AFM323wf5 (GeneBridge 4 panel) from GeneMap
| Location (cR3000): | 50.28 cR |
| Lod Score: | P0.90 |
| Data obtained from: | Genethon |
| Marker type: | microsatellite |
| RHDB ID RH15455 |
|
Linkage Mapping
According to:
|
Entry AFM323wf5 from Genethon
| Location: | 20.6 cM |
| Heterozygosity: | 0.84 |
| Number of Alleles: | 11 |
| Allele Size Range: | 260 - 280 bp |
Entry AFM323wf5 from Marshfield
| Location: | 18.26 cM |
| Heterozygosity: | 0.84 |
| Allele Size Range: | 260 - 280 bp |
|
STS to YAC Content Mapping
According to:
|
Entry AFM323WF5 from Whitehead
|
Sequences
According to:
|
Entry AFM323wf5 from Genethon
| CA strand primer: | AGAGAGCACTTGAGTGAAGG |
| GT strand primer: | GGACTTTTCATCCCAAATC |
| Allele Size Range: | 260 - 280 bp |
Full Sequence
|
Entry AFM323WF5 from Whitehead
| Left strand primer: | AGAGAGCACTTGAGTGAAGG |
| Right strand primer: | GGACTTTTCATCCCAAATC |
| Product Size: | 275 |
| Primer 1: | AGAGAGCACTTGAGTGAAGG |
| Primer 2: | GGACTTTTCATCCCAAATC |
| Product Size: | 276
|
GeneMap Primers:
| Left strand primer: | AGGGTTCTCCAGAGAAACAG |
| Right strand primer: | GGACTTTTCATCCCAAATCT |
| Product Size: | 133 |
|
