Location
| |
| Synonyms |
- w6393
- RH31165
- D11S4149
- STS27220
- AFMb285xh9
- SHGC-20656
- AFMb285xh9a
- AFMb285xh9m
- AFMb285xh9a/AFMb285xh9m
|
| Marker types |
- STS mapped on RH map
- Polymorphic marker
- STS mapped on YAC contig
|
| External Links |
--
|
Radiation Hybrid Mapping
According to:
|
AFMb285xh9 (G3 panel) from Stanford
| Location (cR10,000): | 303 cR |
| Bin 14 |
AFMb285xh9 (G3 panel) from GeneMap
| Location (cR10,000): | 303 cR |
| Lod Score: | F |
| Data obtained from: | Stanford Human Genome Center |
| Marker type: | microsatellite |
| RHDB ID RH31165 |
|
Linkage Mapping
According to:
|
Entry AFMb285xh9 from Genethon
| Location: | 16.8 cM |
| Heterozygosity: | 0.77 |
| Number of Alleles: | 7 |
| Allele Size Range: | 214 - 226 bp |
Entry AFMb285xh9 from Marshfield
| Location: | 14.52 cM |
| Heterozygosity: | 0.77 |
| Allele Size Range: | 214 - 226 bp |
|
STS to YAC Content Mapping
According to:
|
Entry AFMB285XH9 from Whitehead
|
Sequences
According to:
|
Entry AFMb285xh9 from Genethon
| CA strand primer: | TGAATTATACCCCTGACCAA |
| GT strand primer: | CCCAGCCAATATCAGCA |
| Allele Size Range: | 214 - 226 bp |
Full Sequence
|
Entry AFMB285XH9 from Whitehead
| Left strand primer: | TGAATTATACCCCTGACCAA |
| Right strand primer: | CCCAGCCAATATCAGCA |
| Product Size: | 222 |
| Primer 1: | TGAATTATACCCCTGACCAA |
| Primer 2: | CCCAGCCAATATCAGCA |
| Product Size: | 214
|
GeneMap Primers:
| Left strand primer: | TGAATTATACCCCTGACCAA |
| Right strand primer: | CCCAGCCAATATCAGCA |
| Product Size: | 214 |
|
